View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5316_high_8 (Length: 496)
Name: NF5316_high_8
Description: NF5316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5316_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 462; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 462; E-Value: 0
Query Start/End: Original strand, 1 - 487
Target Start/End: Original strand, 4614756 - 4615248
Alignment:
| Q |
1 |
catttgacgatataatcgaagagttacactattatataatcgtaaattgaaatgaaatagataaagttataaaacctagag------agagttagttaag |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4614756 |
catttgacgatataatcgaagagttacactattatataatcgtaaattgaaatgaaatagataaagttataaaacctagagaaagagagagttagttaag |
4614855 |
T |
 |
| Q |
95 |
cgttaagaatgggtttactgtggtggcggaaggggaagaattcacaacctgaagcgaagttgtcgacgacggagaacgcggcgaagaatggtggtgcctc |
194 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4614856 |
cgttaaggatgggtttactgtggtggcggaaggggaagaattcacaacctgaagcgaagttgtcgacgacggagaacgcggcgaagaatggtggtgcctc |
4614955 |
T |
 |
| Q |
195 |
ggcggtgaaaccaactacggaggcgccagggatgaacggtgcagtggaggttaaacgacctaagaacgcgagtgtttcagttttcgagtttggttcggtt |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4614956 |
ggcggtgaaaccaactacggaggcgccagggatgaacggtgcagtggaggttaaacgacctaagaacgcgagtgtttcagttttcgagtttggttcggtt |
4615055 |
T |
 |
| Q |
295 |
gctgcgagcaacgataaggttactcttgccggttattgtccagtttctgaagatcttgagccttgccgttgggagatcctaccggcggttgagtcaaacg |
394 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4615056 |
gctgcgagcaacgataaggttactcttgccggttattgtccagtttctgaagatcttgagccttgccgttgggagatcctaccggcggttgagtcaaacg |
4615155 |
T |
 |
| Q |
395 |
cgccgcagtttcgcgttgttttctgatatctcatgttatgtgtattcttgtttagttttgcgaactatttatttgaacccaaattgatgatgt |
487 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4615156 |
cgccgcagtttcgcgttgttttctgatatctcatgttatgtgtattcttgtttagttttgcgaactatttatttgaaccgaaattgatgatgt |
4615248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University