View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5316_low_12 (Length: 438)
Name: NF5316_low_12
Description: NF5316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5316_low_12 |
 | |
|
| [»] scaffold0140 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0140 (Bit Score: 332; Significance: 0; HSPs: 1)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 25 - 420
Target Start/End: Complemental strand, 32730 - 32335
Alignment:
| Q |
25 |
ccgttttttcatgttttaattcaatgaatttctctttgatatgaattaattcgagtttattccgtctatttcttcatttcatttcat-----aggaaaaa |
119 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
32730 |
ccgttttttcatgttttaatttaatgaatttctctttgatatgaatt----cgagtttattccgtctatttcttcatttcatttcatttcatatgaaaaa |
32635 |
T |
|
| Q |
120 |
gacgtacggtcaagatatggcttgatgagtaatgtatatagacctaggtagttagtgtttggtgactaaccctaaccctaacatgtgtagatttatatta |
219 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32634 |
gacgtacggtcaatatatggcttgatgagtactgtatatagacctaggtagttagtgtttggtgactaaccctaaccctaacatgtgtagatttatatta |
32535 |
T |
|
| Q |
220 |
aaagctagtaggggtaaggcactatagctatgatgaagagaaggaaaatatgatcaatatatagcttaattatgaagaatcgaccacactttattattgg |
319 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32534 |
aaagctagtaggggtaaagcactatagctatgatgaagagaaggaaaatatgatcaatatatagcttaattatgaagaatcgaccacactttattattgg |
32435 |
T |
|
| Q |
320 |
tgcatgctcatatagtatttccacaatatacagctaaatgtggtgccctccttttcacaaacggacaatactaaaaattggaactcaaggaaggaatgct |
419 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32434 |
tgcatgctcatttagtatttccacaatatacagctaaatgtggtgccctcc-tttcacaaacggacaatactaaaaattggaactcaaggaaggaatgct |
32336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University