View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5316_low_15 (Length: 407)
Name: NF5316_low_15
Description: NF5316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5316_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 263; Significance: 1e-146; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 98 - 389
Target Start/End: Complemental strand, 4614704 - 4614409
Alignment:
| Q |
98 |
cataatcttacacattgttttagtaaatctgaatctgtgtttgtgtgttcaagtcatgaatgaagaacaaaaatctctgcttctagaatcttcttctcgc |
197 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4614704 |
cataatcttacacattgtttcagtaaatctgaatctgtgtttgtgtgttgaagccatgaatgaagaacaaaaatctctgcttctagaatcttcttctcgc |
4614605 |
T |
|
| Q |
198 |
ttcttactctcacaaggttcttcgcaatttcacttttgtatattccaactaacaaaacgatgtcgttttcgttgtctgattctgttattgctgttaatac |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4614604 |
ttcttactctcacaaggttcttcgcaatttcacttttgtatattccaactaacaaaacgatgtcgttttcgttgtctgattctgttattgctgttaatac |
4614505 |
T |
|
| Q |
298 |
ggttgagttttgtgtgt----gtgtaggagtgaaggtatcctatggtacagcggggtttagagaagatgcatcgattctgtcgtcgacagtgtaca |
389 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4614504 |
ggttgagttttgtgtgtgtgtgtgtaggagtgaaggtatcctacggtacagcggggtttagagaagatgcatcgattctgtcgtcgacagtgtaca |
4614409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 4614804 - 4614737
Alignment:
| Q |
1 |
caatttacgattatataatcatgtaactcttcgcttatatcgtcaaatgacgtttttgccctttcttc |
68 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4614804 |
caatttacgattatataatagtgtaactcttcgattatatcgtcaaatgacgtttttgccctttcttc |
4614737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University