View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5316_low_26 (Length: 292)
Name: NF5316_low_26
Description: NF5316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5316_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 19 - 286
Target Start/End: Original strand, 3007914 - 3008181
Alignment:
| Q |
19 |
aggaaaaggttctgagatcggcgactttcttacaatgcatccaggggtgaactgcataaggtaatatccacttcttcagctatcttgttagcattactgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3007914 |
aggaaaaggttctgagatcggcgactttcttacaatgcatccaggggtgaactgcataaggtaatatccacttcttcagctatcttgttaacattactgt |
3008013 |
T |
 |
| Q |
119 |
ccaattttgtgtttggttttattatacaaaaatgtatagagtaaaccgcgtcattttggtccctaaagtgtgtgaggcagtgtcattgtagtcgatgaat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3008014 |
ccaattttgtgtttggttttattatacaaaaatgtatagagtaaaccgcgtcattttggtccctaaagtgtgtgaggcagtgtcattgtagtcgatgaat |
3008113 |
T |
 |
| Q |
219 |
gtattgaaatttgaaaaatatccttgattgtgtcttttgttagcaattttacggaccagacagaataa |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3008114 |
gtattgaaatttgaaaaatatccttgattgtgtcttttgttagcaattttacggaccagacagaataa |
3008181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University