View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5316_low_30 (Length: 258)
Name: NF5316_low_30
Description: NF5316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5316_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 72; Significance: 8e-33; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 36416206 - 36416131
Alignment:
| Q |
1 |
aaataaaaatacaatgttggataacttttggaacgttcaaacaacttttctagttaaagaatcgtattcccaccca |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36416206 |
aaataaaaatacaatgttggataacttttggaatgttcaaacaacttttctagttaaagaatcgtattcccaccca |
36416131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 143 - 183
Target Start/End: Complemental strand, 36416065 - 36416025
Alignment:
| Q |
143 |
gatgaatcaatattaatgaactaagtatgcgaatatttttg |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36416065 |
gatgaatcaatattaatgaactaagtatgcgaatatttttg |
36416025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University