View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5316_low_34 (Length: 250)
Name: NF5316_low_34
Description: NF5316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5316_low_34 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 19 - 234
Target Start/End: Original strand, 37118782 - 37118997
Alignment:
| Q |
19 |
aaaataacgaaaccattttttaatttatgcacatatatgcatgctaccttaaacatatacatattaaattatcaattggaaacaggtgcaaaactagaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37118782 |
aaaataacgaaaccattttttaatttatgcacatatatgcatgctaccttaaacatatacatattaaattatcaattggaaacaggtgcaaaactagaat |
37118881 |
T |
|
| Q |
119 |
cttgctcgacagcaccctgctccatcttgttccattgcttcgcaaccttctgatcagaaccatgactatgtatactctgatcaaattcttttgcagtgtc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37118882 |
cttgctcgacagcaccctgctccatcttgttccattgcttcgcaaccttctgatcagaaccatgactatgtatactctgatcaaattcttttgcagtgtc |
37118981 |
T |
|
| Q |
219 |
atatgaagcatgtaac |
234 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
37118982 |
atatgaagcatgtaac |
37118997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 111 - 234
Target Start/End: Original strand, 37110622 - 37110745
Alignment:
| Q |
111 |
actagaatcttgctcgacagcaccctgctccatcttgttccattgcttcgcaaccttctgatcagaaccatgactatgtatactctgatcaaattctttt |
210 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||| ||||||| |||||||| |||||| | ||||||||||| ||||||| ||||||||||||| |||||| |
|
|
| T |
37110622 |
actagagtcttgcttgacagcaccctgctccaccttgttcaattgcttctcaacctccggatcagaaccactactatgtttactctgatcaaactctttt |
37110721 |
T |
|
| Q |
211 |
gcagtgtcatatgaagcatgtaac |
234 |
Q |
| |
|
|| ||||||||||||||||||||| |
|
|
| T |
37110722 |
gctgtgtcatatgaagcatgtaac |
37110745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University