View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5316_low_35 (Length: 242)
Name: NF5316_low_35
Description: NF5316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5316_low_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 14 - 225
Target Start/End: Original strand, 45757576 - 45757789
Alignment:
| Q |
14 |
gagctggcattcacttcggtgcaacacnnnnnnnctgaaccacaacaatacaatgcttaagccttaatgaataaaaacgcacgtttatattttagaaaaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45757576 |
gagctggcattcacttcggtgcaacactttttttctgaaccacaacaatacaatgcttaagccttaatgaataaaaacgcacgtttatattttagaaaaa |
45757675 |
T |
 |
| Q |
114 |
tgcttctcagacaaaaacatgtaccgtataaaatacgttttccgtatactcaatttcagtgcatcttatgcgttgttggattc--atgtgttgaatatca |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| ||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45757676 |
tgcttctcagacaaaaacatgtaccgtataaaatacggtttccgtacactcaatttcggtgcatcttatgcgttgttggattcatatgtgttgaatatca |
45757775 |
T |
 |
| Q |
212 |
cggttctaagttgt |
225 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
45757776 |
cggttctaagttgt |
45757789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University