View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5316_low_9 (Length: 457)

Name: NF5316_low_9
Description: NF5316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5316_low_9
NF5316_low_9
[»] chr3 (1 HSPs)
chr3 (248-321)||(26174496-26174567)


Alignment Details
Target: chr3 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 248 - 321
Target Start/End: Complemental strand, 26174567 - 26174496
Alignment:
248 aaacattagcctgatgaaggcaaccaatgtgttataaaaatgatgatgtggaatttaaagatgaatctagagtt 321  Q
    |||||||||||||||||||||| |||||||||||| ||| |||||||||||||||||||||||||| |||||||    
26174567 aaacattagcctgatgaaggca-ccaatgtgttattaaa-tgatgatgtggaatttaaagatgaatttagagtt 26174496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University