View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5317_low_1 (Length: 414)

Name: NF5317_low_1
Description: NF5317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5317_low_1
NF5317_low_1
[»] chr2 (1 HSPs)
chr2 (35-74)||(33413253-33413292)


Alignment Details
Target: chr2 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 35 - 74
Target Start/End: Complemental strand, 33413292 - 33413253
Alignment:
35 agtgttacatgcaattgctcacaaacactcaactaaataa 74  Q
    ||||||||||||||||||||||||||||||||||||||||    
33413292 agtgttacatgcaattgctcacaaacactcaactaaataa 33413253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University