View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5318_high_6 (Length: 229)

Name: NF5318_high_6
Description: NF5318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5318_high_6
NF5318_high_6
[»] chr3 (1 HSPs)
chr3 (1-219)||(40626744-40626962)


Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 40626962 - 40626744
Alignment:
1 taattatgagtgaattttgtaattgatattcttgattttgatttaggttttgtaaaggatttgattcattggagacgatatggctaataatgctgctgcg 100  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40626962 taattatgagtggattttgtaattgatattcttgattttgatttaggttttgtaaaggatttgattcattggagacgatatggctaataatgctgctgcg 40626863  T
101 tgtgctgagagagcaaccagtgatttgctcattggtcctgattgggctatcaacattgaattatgtgatatcatcaacatggaccctaggtattgttagt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40626862 tgtgctgagagagcaaccagtgatttgctcattggtcctgattgggctatcaacattgaattatgtgatatcatcaacatggaccctaggtattgttagt 40626763  T
201 tcacattgcttgctctctg 219  Q
    |||||||||||||||||||    
40626762 tcacattgcttgctctctg 40626744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University