View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5319_low_5 (Length: 241)
Name: NF5319_low_5
Description: NF5319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5319_low_5 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 20 - 201
Target Start/End: Complemental strand, 47363451 - 47363270
Alignment:
| Q |
20 |
ttaacatagtcttccactggtggctgccaaactggattcggctgctgcacttgttgtgcacctcgaacatcatttgtgcgctagctggacaacttcattt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
47363451 |
ttaacatagtcttccactggtggctgccaaactggattcggctgctgcacttgttgtgcacctcgaacatcatttgtgcgctagctgaacaacttcattt |
47363352 |
T |
 |
| Q |
120 |
ggttctctactccagactttgtcatttcgtcatctccacaagctccaaagtttgtggctgaagcaaaagcatctctgactat |
201 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47363351 |
ggttctctactccagactttgttatttcgtcatctccacaagctccaaagtttgtggctgaagcaaaagcatctctgactat |
47363270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 190 - 241
Target Start/End: Original strand, 34712091 - 34712142
Alignment:
| Q |
190 |
atctctgactatgtcccacaatcatgttgccctccacactttcttcacctct |
241 |
Q |
| |
|
||||||||||| ||||||||| | || ||||||||||||||||||| ||||| |
|
|
| T |
34712091 |
atctctgactacgtcccacaaacctgctgccctccacactttcttcccctct |
34712142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University