View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5320-Insertion-1 (Length: 356)
Name: NF5320-Insertion-1
Description: NF5320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5320-Insertion-1 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 8 - 356
Target Start/End: Complemental strand, 54012656 - 54012308
Alignment:
| Q |
8 |
gatatctcatcctgcatgcatgttccgtttgttctgcgatccgcttcttcatttgcatacactacaagactcttcttcatcccatgtttgccggtaacct |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
54012656 |
gatatctcatcctgcatgcatgttccgtttgttctgcgatccgcttcttcatttgcatacactacaagactcttcttcatcccatgtttgccagtaacct |
54012557 |
T |
|
| Q |
108 |
ttttagttgtgatggcaatgtggctttggtccaaaacatttttacttagtttctattacctccgaggtagactccaccaaacctgggttgtaccgcgatg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54012556 |
ttttagttgtgatggcaatgtggctttggtccaaaacatttttacttagtttctattacctccgaggtagactccaccaaacctgggttgtaccgcgatg |
54012457 |
T |
|
| Q |
208 |
tggctttcaggtcggtcatctattctaaaagtttctctttaagtttaacggtctctacaattgcagcacctgatgaaagtattgannnnnnnnnnnnnnn |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54012456 |
tggctttcaggtcggtcatctattctaaaagtttctctctaagtttaacggtctctacaattgcagcacctgatgaaagtattgatttttttcttttctt |
54012357 |
T |
|
| Q |
308 |
nnncaatattgttaacagtatttcttgccatttgctactgatggaatta |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54012356 |
tttcaatattgttaacagtatttcttgccatttgctactgatggaatta |
54012308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University