View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5320-Insertion-7 (Length: 401)
Name: NF5320-Insertion-7
Description: NF5320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5320-Insertion-7 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 137 - 401
Target Start/End: Complemental strand, 24878949 - 24878675
Alignment:
| Q |
137 |
ccctttgtcggagaagggactt---agctataaaaatgaagggaatataacaagttataaatgcaagaaaaataaaagagggaaatgcagggcatacaac |
233 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24878949 |
ccctttgtcagagaagggacttgatagctataaaaatgacgggaatataacaagttataaatgcaagaaaaataaaagagggaaatgcagggcatacaac |
24878850 |
T |
 |
| Q |
234 |
cccaacagtctgatgcatgttgatgtatttgatttgtttagttgtgatttgagagtttgatgaagggctgcttcacaccctaacctgctgccacagaaac |
333 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24878849 |
cccaacggtctgatgcttgttgatgtatttgatttgtttagttgtgatttgagagtttgatgaagggctgcttcacaccctaacctgctgccacagaaac |
24878750 |
T |
 |
| Q |
334 |
ttcaaatggaaagaagcataaatctttcaaattt-------aatataaaagacaaatcatccatgcataatcaat |
401 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||| ||||||||||||||||||||||| |
|
|
| T |
24878749 |
ttcaaatggaaagaagcataaatctttcaaatttcataaagaacataaaacgcaaatcatccatgcataatcaat |
24878675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 24879078 - 24878997
Alignment:
| Q |
8 |
gtcttctagcctgcagtaaatgcaaataacaacatgaggataaggtattgctatgcacatgaatgtaagcaacaacaacatc |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24879078 |
gtcttctagcctgcagtaaatgcaaataacaacatgaggataaggtattgctatgcacatgaatgtaagcaacaacaacatc |
24878997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University