View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5320_high_12 (Length: 300)
Name: NF5320_high_12
Description: NF5320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5320_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 13 - 281
Target Start/End: Original strand, 49432781 - 49433049
Alignment:
| Q |
13 |
atactgtccctgtttgtaaattgttgtaattacacaatcaagaatattattatgtaccgttgtatatgctttgagtcaaacaaacacctccatgagacca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49432781 |
atactgtccctgtttgtaaattgttgtaattacacaatcaagaatattattatgtaccgttgtatatgctttgagtcaaacaaacacctccatgagacca |
49432880 |
T |
 |
| Q |
113 |
ttcatctttccagcttcattgatctgggcttaggttgtgacatagctttctcttgttcagtaagtgcatgacggaaatggcatctatggccataagggca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49432881 |
ttcatctttccagcttcattgatctgggcttaggttgtgacatagctttctcttgttcagtaagtgcatgacggaaatggcatctatggccataagggca |
49432980 |
T |
 |
| Q |
213 |
cacaaccccagcaaggaccatcctgcagacctcagttttgtagcgtgggtggcggatcactgggcgaag |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49432981 |
cacaaccccagcaaggaccatcctgcagacctcagttttgtagcgtgggtggcggatcactgggcgaag |
49433049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 152 - 281
Target Start/End: Original strand, 39170714 - 39170843
Alignment:
| Q |
152 |
acatagctttctcttgttcagtaagtgcatgacggaaatggcatctatggccataagggcacacaaccccagcaaggaccatcctgcagacctcagtttt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39170714 |
acatagctttctcttgttcagtaagtgcatgacggaaatggcatctatggccacacgggcacacaaccccagcaaggaccatcctgcagacctcagtttt |
39170813 |
T |
 |
| Q |
252 |
gtagcgtgggtggcggatcactgggcgaag |
281 |
Q |
| |
|
||||||||| |||||||||| | ||||||| |
|
|
| T |
39170814 |
gtagcgtggatggcggatcatttggcgaag |
39170843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University