View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5320_high_14 (Length: 260)
Name: NF5320_high_14
Description: NF5320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5320_high_14 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 10 - 260
Target Start/End: Original strand, 38556184 - 38556436
Alignment:
| Q |
10 |
aagaatatgatccatataatggttatgattttcaatcatataaactaaattaattctcaccatagtggatgttatccatctnnnnnnnntgttaaccttc |
109 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||| ||| ||||||||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
38556184 |
aagaatatgatccatataatggatatgattatcaaccatttaaactaaattaattctcaccatagtggatgttatccatctaaaaaaaatgttcaccttc |
38556283 |
T |
 |
| Q |
110 |
aagtaaattcatatcatattatgtgcgagaagctgatttat--acaatgacccaggtgatatgcttgtttacgaaccatctatttctagaatcgacaccg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38556284 |
aagtaaattcatatcatattatgtgcgagaagctgatttattaacaatgacccaggtgatttgcttgtttatgaaccatctatttctagaatcgacacca |
38556383 |
T |
 |
| Q |
208 |
ccaaattagtcaactattggttaacttttgtttcgaggtcaaatctgtaggta |
260 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38556384 |
ccaaattagtcaactattggttagcttttgtttcgaggtcaaatctgtaggta |
38556436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University