View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5320_high_18 (Length: 248)
Name: NF5320_high_18
Description: NF5320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5320_high_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 22 - 234
Target Start/End: Complemental strand, 26913437 - 26913225
Alignment:
| Q |
22 |
cccatgagaacgacggtgttccatttcaccaccacttacaacctcatgaaaaacattgtttgaatcatcaccctcgataaatggctccaccaccatgtca |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26913437 |
cccatgagaacgacggtgttccatttcaccaccacttacaacctcatgaaaaacattgtttgaatcatcaccctcgataaatggctccaccaccatgtca |
26913338 |
T |
|
| Q |
122 |
tttttcagcatttgttcatggttttcaaaaccgccataaaaatgagtcggtagtttagcttcggattcaaacctaggaaaagtgagtaggtggtttggaa |
221 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||| |||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26913337 |
tttttcagcacttgttcatggttttcaaaactgccatgaaaatgggtcggtagtttagcttcggattcaaacctaggaaaagtgggtaggtggtttggaa |
26913238 |
T |
|
| Q |
222 |
gtggatgaaagtg |
234 |
Q |
| |
|
||||||||||||| |
|
|
| T |
26913237 |
gtggatgaaagtg |
26913225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 30 - 96
Target Start/End: Original strand, 3804503 - 3804569
Alignment:
| Q |
30 |
aacgacggtgttccatttcaccaccacttacaacctcatgaaaaacattgtttgaatcatcaccctc |
96 |
Q |
| |
|
||||||||||||||||||| |||||||| | ||||||||||||| ||| ||||| |||| ||||||| |
|
|
| T |
3804503 |
aacgacggtgttccatttctccaccactaataacctcatgaaaagcatggtttgcatcaccaccctc |
3804569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University