View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5320_low_10 (Length: 325)
Name: NF5320_low_10
Description: NF5320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5320_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 55 - 308
Target Start/End: Original strand, 47729435 - 47729686
Alignment:
| Q |
55 |
agcatttagatgaagtttattttacacaacaccaattatgcaaaaaaggaagataaatagtggtacctttgaatgtctcccatgggtagataataccatc |
154 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47729435 |
agcatttagatgaagtttattttacaca-caccaattatgcaaaaaatgaagataaatagtggtacctttgaatgtctcccatgggtagataataccatc |
47729533 |
T |
 |
| Q |
155 |
attgtcaatgtcgaagaaggatgcatgttgttgaagcacagacatgtcattatgcttgtggccccatgtgccattcacattctctgcatcaggggcaacc |
254 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47729534 |
attgtcaatgtcgaagaaggctgcatgttgttgaagcacagacatgtcattatgcctgtggccccatgtgccattcacattctctgcatcaggggcaacc |
47729633 |
T |
 |
| Q |
255 |
aaggctcttggcatatctgaacccaaaattaagtacacaaaaaccataatggca |
308 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47729634 |
aaggctcttggcatatctg-acccaaaattaagtacacaaaaaccataatggca |
47729686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University