View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5320_low_21 (Length: 215)
Name: NF5320_low_21
Description: NF5320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5320_low_21 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 24 - 215
Target Start/End: Original strand, 45204332 - 45204523
Alignment:
| Q |
24 |
ttgaatgatgctttattttggagttcttgaatttactttggcttgcnnnnnnnnnnnnnagttggaacttgaacttgaaccataatattttaactcatta |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45204332 |
ttgaatgatgctttattttggagttcttgaatttactttggcttgcttttttattttttagttggaacttgaacttgaaccataatattttaactcatta |
45204431 |
T |
 |
| Q |
124 |
actattttcaaattagttaaactatccaatcatatttgtaaaagtatctttatatcatttggcaaacagaaacaacaattgaaatatcaacc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45204432 |
actattttcaaattagttaaactatccaatcatatttgtaaaagtatctttatatcatttggcaaacagaaacaacaattgaactatcaacc |
45204523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University