View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5322_high_3 (Length: 294)
Name: NF5322_high_3
Description: NF5322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5322_high_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 271
Target Start/End: Complemental strand, 3242397 - 3242115
Alignment:
| Q |
1 |
gcaaaactactatagtggactaaacttaatttcggataaggatttgatc-------tctttttaggtcattttgatccacttgcatataaattttcaagc |
93 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| ||||||||| | |
|
|
| T |
3242397 |
gcaaaactactatagtggacttaacttaatttcggataaggatttgatcatttatctctttttaggtcattttgatccgcttgcatatgaattttcaaac |
3242298 |
T |
|
| Q |
94 |
tttaaacctaaagttcatatgcaa-----ggtgacgaaaaatagttttaccaacttaaaaaattatcaacaccatagctattagcaaaacatatgttttc |
188 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3242297 |
tttaaacctaaagttcatattcaaacatcggtgacgaaaaatagttttaccaacttaaaaaattatcaacaccatagccattagcaaaacatatgttttc |
3242198 |
T |
|
| Q |
189 |
gtatcagatattataaaatcaaaattgccataaaaaacagttggatatatacaccaacaatatagaagatagtacctaaggct |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3242197 |
gtatcagatattataaaatcaaaattgccataaaaaacagttggatatatacatcaacaatatagaagatagtacctaaggct |
3242115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University