View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5322_high_5 (Length: 218)

Name: NF5322_high_5
Description: NF5322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5322_high_5
NF5322_high_5
[»] chr1 (1 HSPs)
chr1 (17-204)||(620198-620385)


Alignment Details
Target: chr1 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 17 - 204
Target Start/End: Complemental strand, 620385 - 620198
Alignment:
17 aaaatattatgtgtatcactttgcctcttcaaacaaaatatcatgtgtatcactcttaaatcatacannnnnnnngtcttagtccatctgatattcgcat 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         |||||||||||||||||||||||||    
620385 aaaatattatgtgtatcactttgcctcttcaaacaaaatatcatgtgtatcactcttaaatcatactttttttttgtcttagtccatctgatattcgcat 620286  T
117 aaaagagtctcgatgttcagagtttaacaaggagagataaataaagtctaataaacaattgttttaaacaaacccaaacttaagtttt 204  Q
    |||||||||||||| | |||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
620285 aaaagagtctcgatatccagagtttgacaaggagagataaataaaatctaataaacaattgttttaaacaaacccaaacttaagtttt 620198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University