View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5323_high_18 (Length: 309)
Name: NF5323_high_18
Description: NF5323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5323_high_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 3e-48; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 1 - 146
Target Start/End: Original strand, 44285746 - 44285890
Alignment:
| Q |
1 |
acctttactctctgtctcaatcgagccggtcagatcaatagagaagtcaggcactcgatagacttaaaggaaggttccgcccgtaaatttcttgatcaat |
100 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| ||||||||||||| ||||| ||||||||| ||||||||| |
|
|
| T |
44285746 |
acctttactctctgtctcaatcaattcggtcagatcaatagagaagtcaggcactcgattgacttaaaggaagattccg-ccgtaaattgattgatcaat |
44285844 |
T |
|
| Q |
101 |
gttaccgggaagcagcaacagagacagattgagtgctaaagcttct |
146 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
44285845 |
gttaccgggaagcagcaacagagatggattgagtactaaagcttct |
44285890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 44070267 - 44070126
Alignment:
| Q |
1 |
acctttactctctgtctcaatcgagccggtcagatcaatagagaagtcaggcactcgatagacttaaaggaaggttccgcccgtaaatttcttgatcaat |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |||| |||| ||||| || |
|
|
| T |
44070267 |
acctttactctctgtctcaatctagccggtcagatcaatagagaagtcaggcacttgattgacttaaaggaaggttccg-ccgttaattgattgattgat |
44070169 |
T |
|
| Q |
101 |
gttaccgggaagcagcaacagagacagattgagtgctaaagct |
143 |
Q |
| |
|
||| || ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44070168 |
gttgccaggaagcagcaacagagacagattgagtactaaagct |
44070126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 48 - 143
Target Start/End: Complemental strand, 16443843 - 16443749
Alignment:
| Q |
48 |
caggcactcgatagacttaaaggaaggttccgcccgtaaatttcttgatcaatgttaccgggaagcagcaacagagacagattgagtgctaaagct |
143 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||| || |||| ||||| ||||| || ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16443843 |
caggcacttgattgacttaaaggaaggttccgcc-gttaattgattgattgatgttgccaggaagcagcaacagagacagattgagtactaaagct |
16443749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University