View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5323_high_19 (Length: 307)
Name: NF5323_high_19
Description: NF5323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5323_high_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 1 - 299
Target Start/End: Complemental strand, 22155305 - 22155007
Alignment:
| Q |
1 |
tctctccttgcccaatccatgtcagaactgtccctatctttttgcctatcaaatccgtcagtatttgtatgcaattgatgggccaagctacgatgccggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22155305 |
tctctccttgcccaatccatgtcagaactgtccctatctttttgcctatcaaatccgtcagtatttgtatgcaattgatgggccaagctacgatgccggt |
22155206 |
T |
 |
| Q |
101 |
ccttgtaagggtatgatccatctctacctctaagtaccatgtgatttctttcgggatcttgctttccatcatgctcttttctatagaatccctgctcatt |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22155205 |
ccttgtaagggtatgatccctctctacctctaagtaccatgtgatttctttcgggatcttgctttccatcatgctcttttctatagaatccctgctcatt |
22155106 |
T |
 |
| Q |
201 |
ttcatcagggtgttgtctgatgctagccagacgtgttgatcgtggatcctggactacttcttcatcaagaccctctcgtcgcttctgattatctctgct |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22155105 |
ttcatcagggtgttgtctgatgctagccagacgtgttgatcgtggatcctggactacttcttcatcaagaccctctcgtcgcttctgattatctctgct |
22155007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University