View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5324-Insertion-10 (Length: 230)
Name: NF5324-Insertion-10
Description: NF5324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5324-Insertion-10 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 8 - 230
Target Start/End: Original strand, 26454957 - 26455179
Alignment:
| Q |
8 |
cataatctcatctaacttaaagggtttcctttaatgctagttgggtggaggtacttgtgtttgatttagaaagttgttgcaccacttcatattatgatga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26454957 |
cataatctcatctaacttaaagggtttcctttaatgctagttgggtggaggtacttgtgtttgatttagaaagttgttgcaccacttcatattatgatga |
26455056 |
T |
 |
| Q |
108 |
ttttttcttgcattaatgtaggtgttaaaaaatgggttgcctctcttgtaatcaccacgtagttggcttcctcagttgtatcttcaacaatgccttcctt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
26455057 |
ttttttcttgcattaatgtaggtgttaaaaaatgggttgcctctcttgtaatcaccacgtagttggcttcctcagttgtatcttcaacaatgccttactt |
26455156 |
T |
 |
| Q |
208 |
gttctatttcccataattacact |
230 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
26455157 |
gttctatttcccataattacact |
26455179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University