View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5324-Insertion-6 (Length: 218)
Name: NF5324-Insertion-6
Description: NF5324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5324-Insertion-6 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 8 - 218
Target Start/End: Complemental strand, 4078258 - 4078048
Alignment:
| Q |
8 |
ccctcagtttgggaggaattccaagaacttgagatacaaatgatgcaaagtccatatcctccctagttttttgcagtcgaacaaggcataaatttcatct |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4078258 |
ccctcagtttgggaggaattccaagaacttgagatacaaatgatgcaaagtccatatcctccctagttttttggagtcgaacaaggcataaatttcatct |
4078159 |
T |
|
| Q |
108 |
attatccaatcaatctcaccctcgttatgttccaccctcacttgtgtgaatatattctatgtgtcaaccattcctagatcttcttctccactaatcatca |
207 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4078158 |
attatccaatcaatctcacccttgttatgtgccaccctcacttgtgtgaatatattctatgtgtcaaccattcctaaatcttcttctccactaatcatca |
4078059 |
T |
|
| Q |
208 |
ctgctactaga |
218 |
Q |
| |
|
||||||||||| |
|
|
| T |
4078058 |
ctgctactaga |
4078048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 8 - 175
Target Start/End: Complemental strand, 4101013 - 4100846
Alignment:
| Q |
8 |
ccctcagtttgggaggaattccaagaacttgagatacaaatgatgcaaagtccatatcctccctagttttttgcagtcgaacaaggcataaatttcatct |
107 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4101013 |
ccctcagtttaggaggaattccaagaacttgagatacaaatgatgcaaagtccatatcctccctagttttttgcagttgaacaaggcataaatttcatct |
4100914 |
T |
|
| Q |
108 |
attatccaatcaatctcaccctcgttatgttccaccctcacttgtgtgaatatattctatgtgtcaac |
175 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4100913 |
attatccaatcaatctcacccttgttatgtgccaccctcacttgtgtgaatatattctacgtgtcaac |
4100846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 15 - 72
Target Start/End: Original strand, 4502620 - 4502677
Alignment:
| Q |
15 |
tttgggaggaattccaagaacttgagatacaaatgatgcaaagtccatatcctcccta |
72 |
Q |
| |
|
|||||||||||||||| |||||| || ||||| |||||| ||||||||||||||||| |
|
|
| T |
4502620 |
tttgggaggaattccatgaactttaggtacaactgatgcggagtccatatcctcccta |
4502677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 65
Target Start/End: Complemental strand, 19568765 - 19568715
Alignment:
| Q |
15 |
tttgggaggaattccaagaacttgagatacaaatgatgcaaagtccatatc |
65 |
Q |
| |
|
|||| ||||||||||| |||||||||||||| ||||| || |||||||||| |
|
|
| T |
19568765 |
tttgagaggaattccatgaacttgagatacagatgatacatagtccatatc |
19568715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University