View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5324_high_13 (Length: 326)
Name: NF5324_high_13
Description: NF5324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5324_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 1 - 306
Target Start/End: Complemental strand, 7475014 - 7474709
Alignment:
| Q |
1 |
tgacaacatggcagccccgccgcaaggtctccctcttcagacggcggaaggttcaaacggtgaggctaggcagcaagaaaccacgacggagaataattgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7475014 |
tgacaacatggcagccccgccgcaaggtctccctcttcagacggcggaaggttcaaacggtgaggctaggcagcaagaaaccacgacggagaataattgg |
7474915 |
T |
 |
| Q |
101 |
tggcatagttagaatgtttaaaaggatgcgtgtaaagtggcttaagttacaatatcttaggttattaaaacggcttaaggaacattatagaaacgttgtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7474914 |
tggcatagttagaatgtttaaaaggatgcgtgtaaagtggcttaagttacaatatcttaggttgttaaaacggcttaaggaacattatagaaacgttgtg |
7474815 |
T |
 |
| Q |
201 |
aaagatcttattgaagctggtgctaccattgaaacttttcaacaacgcctttttatggaaagcacttttgctgtccctcttggtgttaacttatctactt |
300 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7474814 |
aaagatctcattgaagctggtgctaccattgaaacttttcaacaacgcctttttatggaaagcacttttgctgtccctcttggtgttaacttatctactt |
7474715 |
T |
 |
| Q |
301 |
atcctt |
306 |
Q |
| |
|
|||||| |
|
|
| T |
7474714 |
atcctt |
7474709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University