View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5324_high_14 (Length: 319)

Name: NF5324_high_14
Description: NF5324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5324_high_14
NF5324_high_14
[»] chr5 (1 HSPs)
chr5 (1-39)||(29585934-29585972)


Alignment Details
Target: chr5 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 29585972 - 29585934
Alignment:
1 catgctgtacatgaagatatgcagatttagttcaaagat 39  Q
    |||||||||||||||||||||||||||||||||||||||    
29585972 catgctgtacatgaagatatgcagatttagttcaaagat 29585934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University