View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5324_low_18 (Length: 254)
Name: NF5324_low_18
Description: NF5324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5324_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 45 - 238
Target Start/End: Original strand, 50117695 - 50117888
Alignment:
| Q |
45 |
tatattgatatggaagaggcatatgattggttcatatagaggttttctttaagattttagtgaaaaaagcctagaagtagaaaggagatcagaactttga |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50117695 |
tatattgatatggaagaggcatatgattggttcatatagaggttttctttaagattttagtgaaaaaagcctagaagtagaaaggagatcagaactttga |
50117794 |
T |
|
| Q |
145 |
attgcttatatgttctatctaaccagttgaataagatagtacaatacaaggggatcatgactagccagtagcgtgaaagtacagtgtgaaggat |
238 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50117795 |
attgcttatatgttatatctaaccagttgaataagatagtacaatacaaggggatcatgactagccagtagcgtgaaagtacagtgtgaaggat |
50117888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 50117602 - 50117651
Alignment:
| Q |
1 |
aaaggggataattgtcacaagttattttccaacatcagcatgcatatatt |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
50117602 |
aaaggggataattgtcacaagttattttccaacatcagcatgcatctatt |
50117651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University