View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5325-Insertion-1 (Length: 144)
Name: NF5325-Insertion-1
Description: NF5325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5325-Insertion-1 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 85; Significance: 7e-41; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 85; E-Value: 7e-41
Query Start/End: Original strand, 8 - 144
Target Start/End: Original strand, 9587514 - 9587650
Alignment:
| Q |
8 |
ccattgcacttctacaagagaggtttagacaattggaaagagttaaagaaatnnnnnnnnnnnnnnnnctaaagaaaatgctcaatgaaccaaaacaatt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9587514 |
ccattgcacttctacaagagaggtttagacaattggaaagagtaaaagaaatgagagaagagagagagctaaagaaaatgctcaatgaaccaaaacaatt |
9587613 |
T |
|
| Q |
108 |
caattcaaataccattcctagttatgattatgatcaa |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9587614 |
caattcaaataccattcctagttatgattatgatcaa |
9587650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 19 - 59
Target Start/End: Original strand, 55939143 - 55939183
Alignment:
| Q |
19 |
ctacaagagaggtttagacaattggaaagagttaaagaaat |
59 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| |||||||| |
|
|
| T |
55939143 |
ctacaagagaggtttagacagttgcaaagagtgaaagaaat |
55939183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University