View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5325_high_11 (Length: 218)
Name: NF5325_high_11
Description: NF5325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5325_high_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 6e-98; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 12 - 200
Target Start/End: Original strand, 1191140 - 1191328
Alignment:
| Q |
12 |
caaaggacgaaaatgattatttacctatatttttatgtatttgtaaattaaaatggggtaaacatttttacgtgaaatatcacttctctcctaaacccta |
111 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1191140 |
caaaggacgaaaatgactatttacctatatttttatgtatttgtaaattaaaatggggtaaacatttttacgtgaaatatcacttctctcctaaacccta |
1191239 |
T |
 |
| Q |
112 |
atctcccgagagaaagcgagaactgttttctgacttctcttctcaatcaccgcaggaaagtgaaaagttagggtttttcagctccagca |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1191240 |
atctcccgagagaaagcgaaaactgttttctgacttctcttctcaatcaccgcaggaaagtgaaaagttagggtttttcagctccagca |
1191328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 100 - 187
Target Start/End: Original strand, 1177973 - 1178059
Alignment:
| Q |
100 |
tcctaaaccctaatctcccgagagaaagcgagaactgttttctgacttctcttctcaatcaccgcaggaaagtgaaaagttagggttt |
187 |
Q |
| |
|
|||||||||||||| |||||| |||| || | ||| |||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
1177973 |
tcctaaaccctaatttcccgatagaa-gcaaaaacggttttctgacttctcttctcaatcacagcacaaaagtgaaaagttagggttt |
1178059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University