View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5325_high_9 (Length: 228)

Name: NF5325_high_9
Description: NF5325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5325_high_9
NF5325_high_9
[»] chr6 (1 HSPs)
chr6 (34-197)||(4244221-4244385)


Alignment Details
Target: chr6 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 34 - 197
Target Start/End: Original strand, 4244221 - 4244385
Alignment:
34 taaatgttttcatacttagtgtcaaaaaataaattagtttccaatgttgaattgaatatgatatatatgataaatgtgttcatatttaatgtcaaaaatg 133  Q
    |||||||||||||| | |||||||||||||| |||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
4244221 taaatgttttcatattaagtgtcaaaaaatagattagtctccaatgttgaattgaaaatgatatatatgataaatgtgttcatatttaatgtcaaaaatg 4244320  T
134 tctcaaatatgattacttttaatggaacgttatgaattgatactag-cttcaagtgttaaatttt 197  Q
    |||||| |||||||| ||||| |||||| ||||||||||||||||| |||||||| ||| |||||    
4244321 tctcaattatgattagttttagtggaacattatgaattgatactagccttcaagtcttagatttt 4244385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University