View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5325_high_9 (Length: 228)
Name: NF5325_high_9
Description: NF5325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5325_high_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 34 - 197
Target Start/End: Original strand, 4244221 - 4244385
Alignment:
| Q |
34 |
taaatgttttcatacttagtgtcaaaaaataaattagtttccaatgttgaattgaatatgatatatatgataaatgtgttcatatttaatgtcaaaaatg |
133 |
Q |
| |
|
|||||||||||||| | |||||||||||||| |||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4244221 |
taaatgttttcatattaagtgtcaaaaaatagattagtctccaatgttgaattgaaaatgatatatatgataaatgtgttcatatttaatgtcaaaaatg |
4244320 |
T |
 |
| Q |
134 |
tctcaaatatgattacttttaatggaacgttatgaattgatactag-cttcaagtgttaaatttt |
197 |
Q |
| |
|
|||||| |||||||| ||||| |||||| ||||||||||||||||| |||||||| ||| ||||| |
|
|
| T |
4244321 |
tctcaattatgattagttttagtggaacattatgaattgatactagccttcaagtcttagatttt |
4244385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University