View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5327_high_10 (Length: 237)

Name: NF5327_high_10
Description: NF5327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5327_high_10
NF5327_high_10
[»] chr3 (1 HSPs)
chr3 (1-223)||(42698325-42698548)


Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 42698548 - 42698325
Alignment:
1 tgaatggaatcctagtatgttaagcttaacatatcccagaacaccaagagcatatactaaacat-cttcgaacagacaattannnnnnnaatatgcaaaa 99  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||       |||||||||||    
42698548 tgaatggaatcctagtatgttaagcttaacatatcccagaacaccaagagcatatcctaaacattcttcgaacagacaattatttttttaatatgcaaaa 42698449  T
100 tataatagaccattagaccagttttgtgtatctcgataacatcctgtctcttagttttaaggattaaataaaatttctgtcttcaaacacactatattaa 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42698448 tataatagaccattagaccagttttgtgtatctcgataacatcctgtctcttagttttaaggattaaataaaatttctgtcttcaaacacactatattaa 42698349  T
200 attttaattttgatccataaaaat 223  Q
    ||||||||||||||||||||||||    
42698348 attttaattttgatccataaaaat 42698325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University