View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5327_low_11 (Length: 237)
Name: NF5327_low_11
Description: NF5327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5327_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 42698548 - 42698325
Alignment:
| Q |
1 |
tgaatggaatcctagtatgttaagcttaacatatcccagaacaccaagagcatatactaaacat-cttcgaacagacaattannnnnnnaatatgcaaaa |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
42698548 |
tgaatggaatcctagtatgttaagcttaacatatcccagaacaccaagagcatatcctaaacattcttcgaacagacaattatttttttaatatgcaaaa |
42698449 |
T |
 |
| Q |
100 |
tataatagaccattagaccagttttgtgtatctcgataacatcctgtctcttagttttaaggattaaataaaatttctgtcttcaaacacactatattaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42698448 |
tataatagaccattagaccagttttgtgtatctcgataacatcctgtctcttagttttaaggattaaataaaatttctgtcttcaaacacactatattaa |
42698349 |
T |
 |
| Q |
200 |
attttaattttgatccataaaaat |
223 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
42698348 |
attttaattttgatccataaaaat |
42698325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University