View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5327_low_9 (Length: 238)
Name: NF5327_low_9
Description: NF5327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5327_low_9 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 937482 - 937702
Alignment:
| Q |
18 |
aagaatactagttgggcacttggtgttgcagtctattgtggccgcgagactaaagctatgcttaacaattcaggagctccatcaaaaagaagtagactag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
937482 |
aagaatactagttgggcacttggtgttgcagtctattgtggccgcgagactaaagctatgcttaacaattcaggagctccatcgaaaagaagtagactag |
937581 |
T |
 |
| Q |
118 |
agacgcggatgaattatgaaatcattatgttgtcgttctttcttgttgcattgtgtacaatcacgtctgtttgtgctgcggtttggttgaagcgccataa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
937582 |
agacgcggatgaattatgaaatcattatgttgtcgttctttcttgttgcattgtgtacaatcacgtctgtttgtgctgcggtttggttgaagcgccataa |
937681 |
T |
 |
| Q |
218 |
ggatgagttgaatctgttgcc |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
937682 |
ggatgagttgaatctgttgcc |
937702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 37 - 97
Target Start/End: Original strand, 16941985 - 16942045
Alignment:
| Q |
37 |
ttggtgttgcagtctattgtggccgcgagactaaagctatgcttaacaattcaggagctcc |
97 |
Q |
| |
|
|||||||||| || |||||||| || ||||| ||||||||||| ||||| ||||||||||| |
|
|
| T |
16941985 |
ttggtgttgccgtgtattgtggtcgtgagacaaaagctatgctcaacaactcaggagctcc |
16942045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University