View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5328_high_4 (Length: 322)
Name: NF5328_high_4
Description: NF5328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5328_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 5 - 304
Target Start/End: Original strand, 26413272 - 26413571
Alignment:
| Q |
5 |
ggcggctcttggtgtggaccttttaaaacatggcaaaatatatacaattatgatataacttatggactgaccgaagaagaagcgaaattggttttaggtg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26413272 |
ggcggctcttggtgtggaccttttaaaacatggcaaaatatatacaattatgatataacttatggactgaccgaagaagaagcgaaattggttttaggtg |
26413371 |
T |
 |
| Q |
105 |
gggaggtagcgttgtggtcagaacaagccgatgaaactgttttggattcgcggctttggcctagaacttctgcaatggctgagtcgttgtggtcgggcaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26413372 |
gggaggtagcgttgtggtcagaacaagccgatgaaactgttttggattcgcggctttggcctagaacttctgcaatggctgagtcgttgtggtcaggcaa |
26413471 |
T |
 |
| Q |
205 |
tagggatgaaaagggtctgaagcgatacgcagaggcaacagatagattgaatgaatggcgaagcagaatggtgagtagaggtataggagctgagcctatt |
304 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26413472 |
tagggatgagaagggtctgaagcgatacgcagaggcaacagatagattgaatgaatggcgaagcagaatggtgagtagaggtataggagctgagcctatt |
26413571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University