View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5328_high_5 (Length: 290)
Name: NF5328_high_5
Description: NF5328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5328_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 99; Significance: 7e-49; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 174 - 272
Target Start/End: Original strand, 49354758 - 49354856
Alignment:
| Q |
174 |
ccatttttagggaagtgagggatgactctgatggattgggagatatgttgcaatctagggtcacccttaagaccattttcttcagcaaacattctgtgt |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49354758 |
ccatttttagggaagtgagggatgactctgatggattgggagatatgttgcaatctagggtcacccttaagaccattttcttcagcaaacattctgtgt |
49354856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 21 - 110
Target Start/End: Original strand, 49354601 - 49354690
Alignment:
| Q |
21 |
attcagttttgtataaataaaaaattaaagagttgcagatctgttggataaaaatccgttcagatagaaactgcatgaagaaaacatggc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
49354601 |
attcagttttgtataaataaaaaattaaagagttgcagatctgttggataaaaatccattcagatagaaactgcatgaagaaaacatggc |
49354690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University