View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5328_low_6 (Length: 282)
Name: NF5328_low_6
Description: NF5328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5328_low_6 |
 | |
|
| [»] scaffold0884 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0884 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: scaffold0884
Description:
Target: scaffold0884; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 18 - 227
Target Start/End: Original strand, 3618 - 3822
Alignment:
| Q |
18 |
aactccatcacttgtatccaaacgtatgcgtgt--ctcacactgtgtgtgaacattttgcatttaaatccttcgtccattgaaaaatatgaaggactctt |
115 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3618 |
aactccatcatttgtatccaaacgtatacgtgtgtctcacactgtgtgtga-------gcatttaaatccttcgtccattgaaaaatatgaaggactctt |
3710 |
T |
|
| Q |
116 |
gaattcatgttatgtgtgcctacttcccaagccaaacagatatcctcaaaagttgcaaaagataattcataaaaacttcgtccgagggaagttatcttac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3711 |
gaattcatgttatgtgtgcctacttcccaagccaaacagatatcctcaaaggttgcaaaagataattcataaaaacttcgtcagagggaagttatcttac |
3810 |
T |
|
| Q |
216 |
aaggcttggttg |
227 |
Q |
| |
|
|||| ||||||| |
|
|
| T |
3811 |
aaggattggttg |
3822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0884; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 225 - 272
Target Start/End: Original strand, 3933 - 3980
Alignment:
| Q |
225 |
ttgatacactgatcctctacaatttcaattcataatgcatctcctttg |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3933 |
ttgatacactgatcctctacaatttcaattcataatgcatctcctttg |
3980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University