View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5328_low_7 (Length: 217)
Name: NF5328_low_7
Description: NF5328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5328_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 50509726 - 50509936
Alignment:
| Q |
1 |
ccataacatggcctctctcttaatcccaatgtctctgcttctaaagcagaaggaatgtagccataccactttgttagagctttgagaaaatggtcatgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50509726 |
ccataacatggcctctctcttaatcccaatgtctctgcttctaaagcagaaggaatgtagccataccactttgttagagctttgagaaaatggtcatgag |
50509825 |
T |
|
| Q |
101 |
cattccgaagggcagtcacataccaattctgaagcnnnnnnnnnnagtaagtcaattctgaagcattgttgatcatcaaaaggatttgcatccaccgggt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50509826 |
cattccgaagggcagtcacataccaattctgaagcttttttttttagtaagtcaattctgaagcattgttgatcatcaaaaggatttgcatccaccgggt |
50509925 |
T |
|
| Q |
201 |
ctggtgctgca |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
50509926 |
ctggtgctgca |
50509936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University