View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5329_high_26 (Length: 265)
Name: NF5329_high_26
Description: NF5329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5329_high_26 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 8e-76; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 122 - 265
Target Start/End: Original strand, 38446002 - 38446145
Alignment:
| Q |
122 |
ttgagaaacaaatccaaaaacaaatagggtgcatgtcaggtttctttcacatcttcgatcgccacccaggaaaacgcatctactccgttaaaagactccc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38446002 |
ttgagaaacaaatccaaaaacaaatagggtgcatgtcaggtttctttcacatcttcgatcgccacccaggaaaacgcatctactccgttaaaagactccc |
38446101 |
T |
|
| Q |
222 |
ttcttcaatatcaacggtatcaattcattcattcatatcatact |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38446102 |
ttcttcaatatcaacggtatcaattcattcattcatatcatact |
38446145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 6 - 55
Target Start/End: Original strand, 38445886 - 38445935
Alignment:
| Q |
6 |
aggagcagagaagcagcagaacagaatgtgagaaactcttcacaatattg |
55 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38445886 |
aggaacagagaagcagcagaacagaatgtgagaaactcttcacaatattg |
38445935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University