View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5329_low_30 (Length: 255)
Name: NF5329_low_30
Description: NF5329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5329_low_30 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 19 - 248
Target Start/End: Original strand, 16537275 - 16537501
Alignment:
| Q |
19 |
tattaagaccattgtttaatatatgaatttcatactaaatataaagaaaaattcattgaaaatgacgtgaatttgatcttcatataactttttcgcatat |
118 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16537275 |
tattaacaccattgtttaatatatgaatttcatactaaatataaagaaaaattcattgaaaatgacgtgaatttgatcttcatataactttttcgcatat |
16537374 |
T |
|
| Q |
119 |
aatttaaaatttgtgaaaagataaactacaaaaatgacagaaaatccaacaaatgcaaggtttaattagagaaatcagacaacatatgcaaatttcacac |
218 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16537375 |
aa---aaaatttgtgaaaagataaactacaaaaatgacagaaaatccaacaaatgcaaggtttaattagagaaatcagacaacatatgcaaatttcacac |
16537471 |
T |
|
| Q |
219 |
acaatttaattaatgttcaaagtataatct |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
16537472 |
acaatttaattaatgttcaaagtataatct |
16537501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University