View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5329_low_37 (Length: 233)

Name: NF5329_low_37
Description: NF5329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5329_low_37
NF5329_low_37
[»] chr3 (2 HSPs)
chr3 (1-191)||(8140603-8140793)
chr3 (23-170)||(8164296-8164443)


Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 8140603 - 8140793
Alignment:
1 tagcatatttcttatgttaattatgaaatttatgtttggtgtcataggctcatcaaaaaggaaaaattggagtgaccttagtgactcacttctttgaacc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8140603 tagcatatttcttatgttaattatgaaatttatgtttggtgtcataggctcatcaaaaaggaaaaattggagtgaccttagtgactcacttctttgaacc 8140702  T
101 atattccaatagtgttgctgataaaaaggctgcaggtcgagcacttgacttcttttttggatggtatgtattttcaaattaagaaagtgta 191  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8140703 atattccaatagtgttgctgataaaaaggctgcaggtcgagcacttgacttcttttttggatggtatgtattttcaaattaagaaagtgta 8140793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 23 - 170
Target Start/End: Original strand, 8164296 - 8164443
Alignment:
23 atgaaatttatgtttggtgtcataggctcatcaaaaaggaaaaattggagtgaccttagtgactcacttctttgaaccatattccaatagtgttgctgat 122  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||| | |||||| | ||||||| || |||||||||||||||||||||||| |||    
8164296 atgaaatttatgtttggtgccataggctcatcaaaaaggaaaaattggaattaccttaattactcactactatgaaccatattccaatagtgttgccgat 8164395  T
123 aaaaaggctgcaggtcgagcacttgacttcttttttggatggtatgta 170  Q
     | || |||||| || ||||||||||||| || |||||||||||||||    
8164396 cacaaagctgcaagtagagcacttgactttttatttggatggtatgta 8164443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University