View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5330-Insertion-6 (Length: 269)
Name: NF5330-Insertion-6
Description: NF5330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5330-Insertion-6 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 8 - 269
Target Start/End: Complemental strand, 41332955 - 41332694
Alignment:
| Q |
8 |
aaatgactggtgagattgaagctaccagtcaaccatcttcctggtggaacatatagttgagaaccaccatttgatgagtactgactcaaatgatctatgg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41332955 |
aaatgactggtgagattgaagctaccagtcaaccatcttcctggtggaacatatagttgagaaccaccatttgatgagtactgactcaaatgatctatgg |
41332856 |
T |
|
| Q |
108 |
ctgactgaaaagcttttgtgttcaaagtatttccatcgccgactgctccaaattctgtcaccgaggcactgtaagctctgcagctcacagcacaatactc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41332855 |
ctgactgaaaagcttttgtgttcaaagtatttccatcgccggccgctccaaattctgtcactgaggcactgtaagctctgcagctcacagcacaatactc |
41332756 |
T |
|
| Q |
208 |
aaaatagaagtcctcaaccggtgttttgcggctctcaactatagacaagcttggcaaagcaa |
269 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41332755 |
aaaatagtagtcctcaaccggtgttttgcggctctcaactatagacaagcttggcaaagcaa |
41332694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University