View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5330_low_8 (Length: 228)
Name: NF5330_low_8
Description: NF5330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5330_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 21 - 164
Target Start/End: Complemental strand, 26599475 - 26599327
Alignment:
| Q |
21 |
ggtctgacatttttggacccaaagaaaatattggagggaccaatccaatattagagggaccaaaagaacacagtgaagattatttttctc-----nnnnn |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26599475 |
ggtctgacatttttggacccaaagaaaatattggagggaccaatccaatattagagggaccaaaagaacacagtgaagattatttttctcaacaaaaaaa |
26599376 |
T |
|
| Q |
116 |
nnnnnctgctgattgagtagattatccttttttaaacgatacccatagt |
164 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26599375 |
aaaaactactgattgagtagattatccttttttaaacgatacacatagt |
26599327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 178 - 211
Target Start/End: Complemental strand, 26599310 - 26599277
Alignment:
| Q |
178 |
tatatatttaccttttggataacatattattcat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
26599310 |
tatatatttaccttttggataacatattattcat |
26599277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University