View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5331_high_3 (Length: 328)
Name: NF5331_high_3
Description: NF5331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5331_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 20 - 317
Target Start/End: Original strand, 9566912 - 9567210
Alignment:
| Q |
20 |
attttggtatcgaacaaaatttgcacatgcgaatgtgctctcatgatttcaatccttgtctaactttaagcctcatcttgtctcgagtcggccc-gtcaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
9566912 |
attttggtatcgaacaaaatttgcacatacgaatgtgctctcatgatttcaatccttgtctaactttaagcctcatcttgtgtcgagtcggccctgtcaa |
9567011 |
T |
 |
| Q |
119 |
taacatctccaagcagaagatgtgcacataactttactcttccacgctaaattgatagcaacatctgtttgttcaatcctataatctttattgaaatctt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9567012 |
taacatctccaagcagaagatgtgcacataactttactcttccacgctaaattgatagcaacatctgtttgttcaatcctataatctttattgaaatctt |
9567111 |
T |
 |
| Q |
219 |
tcaagagagttctaactgaatcaatcaccgatggactcaacagtaacggtacaaaacctgccattgaaaatcttgccttccactttccgaacagttcat |
317 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9567112 |
tcaagagagttctgactgaatcaatcaccgatggactcaacagtaacggtacaaaacctgccattgaaaatcttgccttccactttccgaacagttcat |
9567210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University