View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5331_low_1 (Length: 470)
Name: NF5331_low_1
Description: NF5331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5331_low_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 46; Significance: 5e-17; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 232 - 277
Target Start/End: Original strand, 51273155 - 51273200
Alignment:
| Q |
232 |
ttttcccatttttatcgtaaacaaaactattgaacacccttccaaa |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51273155 |
ttttcccatttttatcgtaaacaaaactattgaacacccttccaaa |
51273200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 384 - 436
Target Start/End: Original strand, 51273302 - 51273359
Alignment:
| Q |
384 |
cttatgttgtattgttcaagtgcg-----ttcatacgaccgagtattttagaccaagt |
436 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
51273302 |
cttaagttgtattgttcaagtgcgaataattcatacgaccgagtattttagaccaagt |
51273359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 294 - 322
Target Start/End: Original strand, 51273212 - 51273240
Alignment:
| Q |
294 |
ccattgcacacttttaacaatatacattt |
322 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
51273212 |
ccattgcacacttttaacaatatacattt |
51273240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University