View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5331_low_8 (Length: 211)
Name: NF5331_low_8
Description: NF5331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5331_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 19 - 196
Target Start/End: Complemental strand, 36794778 - 36794601
Alignment:
| Q |
19 |
attgaggaataatgtgattttgacaaacaagaattctagtttgtgaattttgatatcaaaatgatgatgtagaatgtagagatggtgtatccaaacacnn |
118 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36794778 |
attgaggaataatgtgtttttgacaaacatgaattctagtttgtgaattttgatatcaaaatgatgatgtagaatgtggagatggtgtatccaaacactt |
36794679 |
T |
 |
| Q |
119 |
nnnnnngttcacnnnnnnngtcttagattatatgatttttgttactgtatttttatttacaagctaagatagcttata |
196 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36794678 |
ttttttgttcacaaaaaaagtcttagattatatgatttttgttactgtatttttatttacaagctaagatagcttata |
36794601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University