View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5332-Insertion-5 (Length: 391)
Name: NF5332-Insertion-5
Description: NF5332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5332-Insertion-5 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 8 - 391
Target Start/End: Original strand, 6917005 - 6917398
Alignment:
| Q |
8 |
ctttcaacaatttggagttcattgattcattctgaattatcaccttcacaaagctaaggtttagaaacagtcacacagtgacagacgcagcaatgttcct |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6917005 |
ctttcaacaatttggagttcattgattcattctgaattatcaccttcacaaagctaaggtctagaaacagtcacacagtgacagacgcagcaatgttcct |
6917104 |
T |
 |
| Q |
108 |
ctgaatctcaataggcagaagaactgttggaagaaaattcagtttagtatcattcacggcggcgacagtgaagtctccgttgaaccgccttcattagtca |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6917105 |
ctgaatctcaataggcagaagaactgttggaagaaaattcagtttagcatcattcacggcggcgacagtgaagtctccgccaaaccgccttcattagtca |
6917204 |
T |
 |
| Q |
208 |
aagct-------cgccattgacagcaccccgagtttcccatggacacgctcagagattgatcctgaagccgcagcagtttgagacgagtccgctcccgta |
300 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6917205 |
aagctcgagcagcgccattgacagcacgccgagtttcccacagacacgctcagagattgatcctgaagccgcagcagtttgagacgagtctgctcccgta |
6917304 |
T |
 |
| Q |
301 |
tctggcaatcagtttgagctgtgctgtgctcgtggaagcctagccgcccaggaga--ccgcccaagaatt-atctgaagccgtgttcgttcccg |
391 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||| ||||| ||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6917305 |
tctggcaaacagtttgagctgtgccatgctcgtggaagcgtagccacccaggagaggccgcccaagaattgatctgaagccgtgttcgttcccg |
6917398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University