View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5332_high_12 (Length: 250)
Name: NF5332_high_12
Description: NF5332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5332_high_12 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 21 - 250
Target Start/End: Complemental strand, 2035262 - 2035032
Alignment:
| Q |
21 |
gtccccgaccatattaaatagtggtataatatgcatattgagggtgtaatttgagagcggattttctacggtgcaatagtaaaccaaaacaatgattcgt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || |
|
|
| T |
2035262 |
gtccccgaccatattaaatagtggtataatatgcatattgagggtgtaatttgagagcggattttctacggtgcaatagtaaaccaaaacaataatttgt |
2035163 |
T |
|
| Q |
121 |
ttgttttatctta-caaataccgtagtagatcgtctgtattatacaattcgataaatctcacaaaaagtctcgaagaaatgagcctaatctatgactcaa |
219 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||| ||||||||||||||||||||||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
2035162 |
ttgttttatcttataaaataccgtagttgatcgtctgtattgtacaattcgataaatctcacaaaaaatctcaaaaaaatgagcctaatctatgactcaa |
2035063 |
T |
|
| Q |
220 |
tccaataatataacataattctttcgaaatc |
250 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |
|
|
| T |
2035062 |
tccaataatataacataattcttttgaaatc |
2035032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University