View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5332_low_13 (Length: 246)
Name: NF5332_low_13
Description: NF5332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5332_low_13 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 18 - 246
Target Start/End: Complemental strand, 8219347 - 8219119
Alignment:
| Q |
18 |
aagatatgattacaactatacannnnnnngcacactctcctttctcgtttctctcgttaacttgagctttgagtgctaacctattttatagattcattct |
117 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||||| |||||||||||||||||||||||| || |||| |||||||||||| |
|
|
| T |
8219347 |
aagatatgattacaactatacctttttttgcacactctcctttcttgtttctcttgttaacttgagctttgagtgctaaactgttttgtagattcattct |
8219248 |
T |
|
| Q |
118 |
cctcgttgaagagccaactccacaacattggcaatcatgtttcacaaccactttcttctgttactcatcaacctgatccacgccagctcaagtataaatt |
217 |
Q |
| |
|
|||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8219247 |
cctcattgaagagccacctccacaacattggaaatcatgtttcacaaccactttcttccgttactcatcaacctgatccacgccagctcaagtataaatt |
8219148 |
T |
|
| Q |
218 |
tgagtatatctcacgtctctttcattctt |
246 |
Q |
| |
|
| |||||||||||||||||||||||||| |
|
|
| T |
8219147 |
tatgtatatctcacgtctctttcattctt |
8219119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University