View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5333_high_1 (Length: 254)

Name: NF5333_high_1
Description: NF5333
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5333_high_1
NF5333_high_1
[»] chr4 (1 HSPs)
chr4 (220-254)||(52807330-52807364)


Alignment Details
Target: chr4 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 220 - 254
Target Start/End: Complemental strand, 52807364 - 52807330
Alignment:
220 gtgatgagtgacaagaactataaagaaagcagtga 254  Q
    |||||||||||||||||||||||||||||||||||    
52807364 gtgatgagtgacaagaactataaagaaagcagtga 52807330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University