View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5335-Insertion-3 (Length: 417)

Name: NF5335-Insertion-3
Description: NF5335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5335-Insertion-3
NF5335-Insertion-3
[»] chr7 (3 HSPs)
chr7 (108-193)||(6785709-6785794)
chr7 (8-72)||(6785923-6785987)
chr7 (78-123)||(6785802-6785847)


Alignment Details
Target: chr7 (Bit Score: 62; Significance: 1e-26; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 108 - 193
Target Start/End: Complemental strand, 6785794 - 6785709
Alignment:
Q  108 tttgagctttctcatacctaggttgcctagctgtctcatttgcctttattttctgttttaacttttgatcattgtaactccctata 193  Q
    |||||||||||| |||||||| ||||||||||||||| ||| |||||||||||||||||||||| ||||||||||| |||||||||    
T  6785794 tttgagctttcttatacctagcttgcctagctgtctctttttcctttattttctgttttaacttatgatcattgtatctccctata 6785709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 8 - 72
Target Start/End: Complemental strand, 6785987 - 6785923
Alignment:
Q  8 tcatgaagggtggatattttcttgatggcactagcaggaagtaacttataatgtttgtgcactgt 72  Q
    |||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  6785987 tcatgaagggtgaatattttcttgatggcactaacaggaagtaacttataatgtttgtgcactgt 6785923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 78 - 123
Target Start/End: Complemental strand, 6785847 - 6785802
Alignment:
Q  78 agtattagttatttcatttgcattcatgaatttgagctttctcata 123  Q
    |||||||||||||| |||||||||||||||||||||||||||||||    
T  6785847 agtattagttatttgatttgcattcatgaatttgagctttctcata 6785802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University